|
|
|
|
Dave W.
Info Junkie
USA
26022 Posts |
 Posted - 08/14/2004 : 11:54:16
|
Okay, folks, another game thread, and here's the challenge:
Take a popular advertising slogan today, and "update" it for the hypothetically-coming age in which molecular-level genetic tinkering with plants and animals is the norm.
For example:
"...'Cause Oscar Mayer has a way with b-o-l-o-D-N-A."
Submit as many as you like.
|
- Dave W. (Private Msg, EMail)
Evidently, I rock!
Why not question something for a change?
Visit Dave's Psoriasis Info, too. |
|
|
N C More
Skeptic Friend
53 Posts |
Posted - 08/15/2004 : 08:25:35 [Permalink]
|
Ok, "It splices, it DNA dices! For all of your genetic recombinative needs...The 'Gene-Su Knife' is all you'll ever need!"
This is a fun idea  |
"An open mind is like an open window...without a good screen you'll get some really weird bugs!" |
 |
|
|
filthy
SFN Die Hard
USA
14408 Posts |
Posted - 08/15/2004 : 08:44:49 [Permalink]
|
Super Suds, Super Suds; splice your jeans in Super Suds!
From a '40s era radio, detergent commercial -- "wash your duds," it went.
Please forgive me, but I really don't know a hell of a lot about genetics beyond splicing fish roe with scrambled chicken eggs, and having a damned good breakfast. Pork brains will also produce excellent results.
But, I will try.
 |
"What luck for rulers that men do not think." -- Adolf Hitler (1889 - 1945)
"If only we could impeach on the basis of criminal stupidity, 90% of the Rethuglicans and half of the Democrats would be thrown out of office." ~~ P.Z. Myres
"The default position of human nature is to punch the other guy in the face and take his stuff." ~~ Dude
Brother Boot Knife of Warm Humanitarianism,
and Crypto-Communist! 
|
|
|
|
Dave W.
Info Junkie
USA
26022 Posts |
Posted - 08/15/2004 : 19:10:24 [Permalink]
|
Hehehe. "Spice your jeans." This is off topic but:
Q: Why do we know that diarrhea is hereditary?
A: It runs in your jeans. |
- Dave W. (Private Msg, EMail)
Evidently, I rock!
Why not question something for a change?
Visit Dave's Psoriasis Info, too. |
|
|
|
N C More
Skeptic Friend
53 Posts |
Posted - 08/16/2004 : 12:03:55 [Permalink]
|
Q: How do we know that insanity is an example of "reverse heredity"?
A: Because you get it from your children! |
"An open mind is like an open window...without a good screen you'll get some really weird bugs!" |
|
|
|
Valiant Dancer
Forum Goalie
USA
4826 Posts |
Posted - 08/16/2004 : 12:21:00 [Permalink]
|
I'm probably gonna regret this but...
Splice your DNA with a Chevrolet.
and
Oh, I wish I was an Oscar Meyer mu-tant
That is what I'd truely like to be.
For if I was an Oscar Meyer mu-tant
Everyone would be so jealous of me.
|
Cthulhu/Asmodeus when you're tired of voting for the lesser of two evils
Brother Cutlass of Reasoned Discussion |
|
|
|
Ricky
SFN Die Hard
USA
4907 Posts |
|
|
filthy
SFN Die Hard
USA
14408 Posts |
Posted - 08/16/2004 : 13:47:59 [Permalink]
|
I crackle 'cause I'm crisp,
I taste better 'cause I'm fresh,
I'm a treat full of zip,
I'm a cloned potato chip!
This is making me wish I paid more attention to TV. Or maybe not.
|
"What luck for rulers that men do not think." -- Adolf Hitler (1889 - 1945)
"If only we could impeach on the basis of criminal stupidity, 90% of the Rethuglicans and half of the Democrats would be thrown out of office." ~~ P.Z. Myres
"The default position of human nature is to punch the other guy in the face and take his stuff." ~~ Dude
Brother Boot Knife of Warm Humanitarianism,
and Crypto-Communist!
|
|
|
|
Dave W.
Info Junkie
USA
26022 Posts |
Posted - 08/16/2004 : 14:57:02 [Permalink]
|
ROLLING ROCK
From the precisely designed nematodes of
OLD LATROBE
we tender this premium beer
for your enjoyment, as a
tribute to your good taste.
It comes
from the UG1278XXZ strains
to you
"33" |
- Dave W. (Private Msg, EMail)
Evidently, I rock!
Why not question something for a change?
Visit Dave's Psoriasis Info, too. |
|
|
|
filthy
SFN Die Hard
USA
14408 Posts |
Posted - 08/16/2004 : 15:58:51 [Permalink]
|
...and they don't take American Express.
Visa, for whatever you want to be.
|
"What luck for rulers that men do not think." -- Adolf Hitler (1889 - 1945)
"If only we could impeach on the basis of criminal stupidity, 90% of the Rethuglicans and half of the Democrats would be thrown out of office." ~~ P.Z. Myres
"The default position of human nature is to punch the other guy in the face and take his stuff." ~~ Dude
Brother Boot Knife of Warm Humanitarianism,
and Crypto-Communist!
|
| Edited by - filthy on 08/16/2004 17:18:56 |
|
|
|
Dave W.
Info Junkie
USA
26022 Posts |
|
|
Dave W.
Info Junkie
USA
26022 Posts |
|
|
H. Humbert
SFN Die Hard
USA
4574 Posts |
Posted - 08/16/2004 : 22:46:28 [Permalink]
|
Nice links, Dave! The very first two I read seemed appropriate. Completely unaltered:
"Free enterprise with every copy."
Brand: The Economist
(I envision a stream of identical-looking business men...)
"Go to work on an egg."
Brand: Egg Marketing Board |
"A man is his own easiest dupe, for what he wishes to be true he generally believes to be true." --Demosthenes
"The first principle is that you must not fool yourself - and you are the easiest person to fool." --Richard P. Feynman
"Face facts with dignity." --found inside a fortune cookie |
| Edited by - H. Humbert on 08/16/2004 22:51:56 |
|
|
|
Ricky
SFN Die Hard
USA
4907 Posts |
|
|
Dave W.
Info Junkie
USA
26022 Posts |
Posted - 08/17/2004 : 06:52:17 [Permalink]
|
"With a sequence likeATTGGCATGCTGATCGATAAAGCTCTCGCC
CCGCTCGCGATAGCTCGATCGCTAGCTCGC
TAGATAAAAATCGCTCTAGCTCGATCCGCG
GCGCGTTATAGCTCGATGAGTGTGTGTGCG
CGCCCTAGAGATAAGAGATAGACACGCGCA
GAATAGACAGCAGATAGAGCAGACAGATGG
TTGTTTTTGCGCGCATAGCAGACGACAGCA
GACit has to be good." - Smuckers |
- Dave W. (Private Msg, EMail)
Evidently, I rock!
Why not question something for a change?
Visit Dave's Psoriasis Info, too. |
|
|
|
 |
|
Topic Locked
